A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence phe-leu-ile-val would be. What amino acid sequence will be generated based on the following mRNA codon sequence.
What Would The Amino Acid Sequence Be Specified By The Transcribed Dna Sequence Quora
What amino acid sequence will be generated based on the following mRNA codon sequence.
. What amino acid sequence will be generated based on the following mRNA sequence. What amino acid sequence will be generated based on the following mRNA codon sequence. 5 AUG-UCU-UCG-UUA-UCC-UUG 3 A.
What amino acid sequence will be generated based on the following mature mRNA coding sequence. Biology questions and answers. What would the amino acid sequence be specified by the transcribed DNA sequence.
Biology questions and answers. Course Title BIO 111. 12 What amino acid sequence will be generated based on the following mRNA codon sequence.
5 AUG-UCU-UCG-UUA-UCC-UUG 3 A met-arg-glu-arg-glu-arg B met-glu-arg-arg-gln-leu C met-ser-leu-ser-leu-ser D met-ser-ser-leu-ser-leu E met-leu-phe-arg-glu-glu. Science Biology QA Library Which amino acid sequence will be generated during translation from the following small mRNACCC-AUG-UCU- UCG-UUA-UGA-UUG. 7 what amino acid sequence will be generated based on.
5-CAG AAG AAA AUU AAC AUG UAA-3 mRNA sequence. What amino acid sequence will be generated based on the following mRNA codon sequence. If the above mRNA code for the protein coat of a virus what steps would you take to develop it into a vaccine.
What amino acid sequence will be generated based on. ACC encodes the amino acid Thr or Tyrosine UUG encodes the amino acid Leu or Leucine GUU encodes the amino acid Val or Valine. Remember where translation starts and stops a Met-Glu-Arg-Arg-Glu-Leu b Met-Ser-Ser-Leu-Leu c Pro-Met-Ser-Ser-Leu-Leu d Pro-Met-Ser-Ser-Leu e Met-Ser-Ser-Leu.
What amino acid sequence will be generated based on the following mRNA codon sequence. 5 AUG-UCU-UCG-UUA-UCC-UUG 3 A met-arg-glu-arg-glu-arg B met-glu-arg-arg-glu-leu C met-ser-leu-ser-leu-ser D met-ser-ser-leu-ser-leu E met-leu-phe-arg-glu-glu 12. For a DNA sequence TGG-AAC-CAA the resulting mRNA is ACC-UUG-GUU which occurs by the complementarity of nitrogen bases.
Met-arg-glu-arg-leu-ser-leu A possible sequence for nucleotides in the template strand of DNA that would code for the polypeptide sequence the-leu-ile-val would be 3. N- MetSer - Ser Leu Ser Leu- C Translation is a cellular process by. How many different sequences of codons can specify the following polypeptide sequence.
What amino acid sequence will be generated based on the following mRNA codon sequence. 5 AAU AUA CGC AAG 3 2. What amino acid sequence will be generated based on the following mRNA codon.
Met - Ala - Pro-Asp 3. So it can produced in large quantities. 5-AUG-UCU-UCG-UUA-UCC-UUG-3 A Met-Ser-Ser-Leu-Ser-Leu B Met-Arg-Glu-Arg-Glu-Arg C Met-Glu-Arg-Arg-Glu-Leu D Met-Ser-Leu-Ser-Leu-Ser.
Remember where translation starts and stops a Met-Glu-Arg-Arg-Glu-Leu b Met-Ser-Ser-Leu-Leu c Pro-Met-Ser-Ser-Leu-Leu d Pro-Met-Ser-Ser-Leu e Met-Ser-Ser-Leu. 5-AUG-UCU-UCG-UUA-UCC-UUG-3 Met-Ser-Ser-Leu-Ser-Leu Use the scheme to answer the question. 3-GTC TTC TTT TAA TTG TAC ATT-5 DNA template strand.
If you mean what you can look that up from the codon table slight variations depending on organism as well as certain non-translated mRNA. 5- AUG-UCU-UCG-UUA-UCC-UUG-3 Corresponding amino acid sequences. 5-AUG-UCU-ACU-UUA-GGU-GUA-UAA-3 G U บบบ PHE UUCS UUA LEU UUG Second base С A UCU UAU TYR UCC UACS SER UCA UAA STOP UCG UA UGUI CYS UGCS UGA STOP UGG TRP Орос VAG DO C --- CUU CUC CUA CUG LEU CCU ССС.
Of the three codons obtained. Do you mean why. Which amino acid sequence will be generated during translation from the following small mRNA.
School Craven Community College. I enzymeXenzymeX II enzymeYenzymeY III The figure shows a simple metabolic pathway. What amino acid sequence will be generated based on the following mRNA codon sequence.
We get the mRNA sequence due the transcription process which gives us the RNA bases that are complementary to the DNA template strand that uses uracil opposite to adenine. What amino acid sequence will be generated based on the following mRNA codon sequence. 5 AUG-UCU-UCG-UUA-UCC-UUG 3 a.
What amino acid sequence will be generated based on the following mRNA codon sequence. USE Table 111 The genetic code p248 5 AUG-UCU-UCG-UUA-UCC-UUG 3 met-leu-phe-arg-glu-glu met-glu-arg-arg-gln-leu met-ser-ser-leu-ser-leu. What amino acid sequence will be generated based on the following m RNA codon sequence.
Corresponding amino acid for given mRNA sequences are as follows. What amino acid sequence would be produced from the mRNA sequence CGCUAUAGC. Pages 26 Ratings 100 1 1 out of 1 people found this document helpful.
The RNA polymerase which is an enzyme that moves from the 3. 3 UGCAUGUCUUCGUUAUCCUUGAAUCAAGGCACCUAAUUU 5 Amino acid sequence. Which of the following sequences of nucleotides are possible in the template strand of DNA that would code for the.
Genetics Deducing Amino Acid Sequence From A Dna Sequence Biology Stack Exchange
Nucleic Acids To Amino Acids Dna Specifies Protein Learn Science At Scitable
Amino Acids And Protein Sequences
0 Comments